chiliboy6826 chiliboy6826

04-05-2018
History

contestada

Why die the fugitive slave law cause the civil war?

Respuesta :

TwentyOnePilotsBest TwentyOnePilotsBest

04-05-2018

The Fugitive Slave Act did not make or cause the US Civil War. The war began in 1861 a full 11 years after the law was passed and Lincoln vowed to enforce it. Therefore, the war and the Fugitive Slave Act are not connected.

Answer Link

Otras preguntas

Which statement is true about nonfiction? Question 1 options: Nonfiction can contain facts, opinions, and ideas. Nonfiction deals with imaginary people and made

what played a great role in the kansan nebraska act

A hat contains three ping-pong balls numbered 1, 2, and 3. kim draws one from the hat. then, without replacing the first ball, she draws another. what is the sa

Select all that apply: according to fisher, the effects of globalization on indigenous peoples include___________.

Find the area of a kite with diagonals 10 & 5

The brackets are indicating a(n) _____ bond. the brackets are indicating a(n) _____ bond. hydrogen polar covalent single (nonpolar) covalent hydrophobic ionic

Exponential Equation WITHOUT CALCULATOR

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

If a family has three children, what is the probability that the family has at least one girl?

Write the equation of the line containing the point (1 2) and parallel to the line 2x + 4y = 1