Sabrina7141
Sabrina7141 Sabrina7141
  • 03-04-2018
  • Mathematics
contestada

how do I help my son with these were problems I have no clue how to do

how do I help my son with these were problems I have no clue how to do class=

Respuesta :

Аноним Аноним
  • 03-04-2018
I think your supposed to put the number in the first column multiply by four and then put the answer in the second column. Like number 2 times 4 is 8, and 3 times 4 is 12.
Answer Link

Otras preguntas

On a map, the distance between two cities is 7.3 centimeters. The map scale is 1 cm:50 km. What is the actual distance between the two cities?
COMPARISON; 1. How is concrete like chocolate 2. How is a shirt like a picture 3. how is an elephant like a cloud
lya took one hour to drive from his apartment to Philips Arena and back. The return drive took 8 minutes less than the trip to the arena. If x represents the ti
Specify, "have" in these proposals is to shock or unstressed? 1) They have not lived here for years. 2) He has a house near the river. 3) Have you finished your
Where did middle names come from
What was George Washington's nickname?
Explain who or what "Año Viejo" is and its significance.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Please help solve, thanks in advance!
Compliant is to stubborn as excited is to