JuneWriter
JuneWriter JuneWriter
  • 03-01-2018
  • Mathematics
contestada

How do I find the slope of: y = -5x -1

Respuesta :

cdbuck
cdbuck cdbuck
  • 03-01-2018
in a slope intercept equation in the form of y=mb+b,
m is the slope. m is the coefficient of x, meaning it is the number x is multiplied by. In this case, m happens to be
-5
which is your answer
Answer Link

Otras preguntas

What are the qualities of a good topic? How will you ensure the topic you choose is relevant and interesting?
How has water influenced the development of civilization in Africa
The area of the base of a prism is 50 mm2. The perimeter of the base is 30 mm. The height of the prism is 7 mm. What is the surface area of the prism?
Kevin will take 4 math tests this term. All of the tests are worth the same number of points. After taking the first 3 tests, his mean test score is 88 points.
what are 2 examples of ionic compound?
How many combinations of 5 students can a teacher choose from 24 students? A. 5,100,480 B. 42,504 C. 7,962,624 D. 120
Who was the Queen of England when Shakespeare first became known as a great playwright? A. Elizabeth I B. Mary Tudor C. Victoria D. Anne Boleyn
Simplify. (-1/2)(4times)(-2)(7y)(-1) A. –28xy B. –28 C. 28xy D. 27
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Divide the polynomial in the numerator by the trinomial in the denominator m^3-m^2-4m+1 /m^2+2m-3