bipulcKrish3876 bipulcKrish3876

02-11-2017
History

contestada

_______ was a teacher who was arrested for teaching evolution in the 1920s

Respuesta :

emmygt824 emmygt824

02-11-2017

John Scopes was arrested for teaching evolution.

Answer Link

Topmadworld Topmadworld

02-11-2017

Hey there,
John Thomas Scopes was a teacher who was arrested for teaching evolution in the 1920s.

Hope this helps :))

~Top

Answer Link

Otras preguntas

What caused the gross domestic product of the united states to quadruple between 1860 and 1890?

__________ involves a rapid loss that occurs just before death. primary aging pathological aging secondary aging tertiary aging

NEED HELP ASAPPPPPPP

The basis of freedom of religion is found in which two principles in the bill of rights

Proof: it is given that angle 1 and angle 2 are supplementary. angle 1 and angle 3 are also supplementary, so angle 2 is equal or equivalent to angle 3. since _

Find the product. (7x-2) (x+y)

A circular swimming pool has a diameter of 12 feet. What is the circumference the pool? Use 3.14 to approximate for π . Enter your answer, as a decimal rou

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

One year ago liz was three times as old as her brother jack. in two years she'll be only twice as old as jack. how old are liz and jack now?

a food worker prepares a raw fish fillet for cooking. what food hazard must be removed during preparation?