beachyguurl beachyguurl
  • 03-10-2015
  • Mathematics
contestada

How many miles do you estimate it would be if you still the strip around the equator

Respuesta :

AL2006
AL2006 AL2006
  • 04-10-2015
It's not possible to come up with an estimate, because nobody here knows what it means to "still the strip".
Answer Link

Otras preguntas

Graph the first six terms of a sequence where a1 = -10 and d = 3.
What is the surface area of the prism? A. 144 in2 B. 420 in2 C. 288 in2 D. 140 in2 I really don't know where to post a link to the prism pic
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
what are 2 examples of ionic compound?
A youth ice hockey game has 3 periods that are each 20 minutes long. Colin plays 12 minutes each period. Which ratio shows Colin's playing time compared to the
Which of the following was not an accomplishment of the emperor Trajanlegalized Christianity       built bridges, aqueducts and harbors       reduced taxes
Which additional word in the poem should be capitalized? Coyote In the night, it prowls alone hidden from view, Stalking prey. Before dawn, Coyote howls.
How do you put allele in a sentence
What is the primary purpose of the Supremacy Clause?
Angela has 24 golf balls and 18 golf clubs. She wants to sell packages of balls and paddles bundled together. What is the greatest number of packages she can se