bri514 bri514
  • 02-10-2017
  • Mathematics
contestada

complete the following equation using <,> or = 3.20_3.02

Respuesta :

ariel1234 ariel1234
  • 02-10-2017
The correct way is 3.20 >3.02 because if you wrote it on a number line 3.02 is smaller and closer to 3 and 3.20 is closer to 4 and farther down the number line which makes it greater.

-----3------l----l-------4--
            3.02  3.20
                       
Answer Link

Otras preguntas

How do you write fifty-seven thousand,eighteen. In standard form
In terms of weather, what kind of boundary does the line labeled  X represent? A. occluded front B. stationary front C. cold front D. warm front
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Which is the best description of civil liberties? A. natural rights B. privileges C. rights guaranteed by law D. democratic goals E. trial procedures
What was religion like in Shang China?
all 231 students in the math club went on a field trip. some students rode in vans ehich hold 7 students each and some students rode in buses which hold 25 stud
how to i do 7/16÷(31/2÷1/2)
A light bulb converts electrical energy into electromagnetic energy is true or false?
What was George Washington's nickname?
HELPPPPP 35% OF GRADEEEEE.... When John bought his new computer, he purchased an online computer help service. The help service has a yearly fee of $25.50 and a