teeclaude78
teeclaude78 teeclaude78
  • 03-09-2017
  • Mathematics
contestada

two different ways to find the value of the expression 5.4 * 1.17 * 100 that do not require you to First multiply 5.4 X 1.17

Respuesta :

coolstick
coolstick coolstick
  • 03-09-2017
Using the commutative property of multiplication, we get that 5.4*1.7*100=
5.4*100*1.7, so we could multiply 5.4 and 100 first, then by 1.7. In addition, we have 1.7*100*5.4 in where we multiply 1.7 and 100, then by 5.4
Answer Link

Otras preguntas

why did Mr Collins come to the Bennet family looking for a wife?
Angela has 24 golf balls and 18 golf clubs. She wants to sell packages of balls and paddles bundled together. What is the greatest number of packages she can se
A generator stores electric current. Explain why you agree or disagree with this statement
Is 5/7 greater than 4/6
A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup
What were the driving forces behind the industrial revolution
In a standard dictionary, where can you find the key to pronunciation marks? A. In an appendix B. In the front of the dictionary C. At the bottom of each page D
Divide the polynomial in the numerator by the trinomial in the denominator m^3-m^2-4m+1 /m^2+2m-3
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
what is 0.00001267 is scientific notation