Tylerdaman Tylerdaman
  • 01-05-2015
  • Social Studies
contestada

a group of people who make laws for and help run a city or town? please help :)

Respuesta :

tiffywiffyjgirl1
tiffywiffyjgirl1 tiffywiffyjgirl1
  • 05-05-2015
Someone who runs a city or town is a governor
Answer Link

Otras preguntas

Where did middle names come from
Gina rented shoes, bowled 3 games, and bought 1 order of nachos. she used a coupon for 1/2 off the price of her bowling games. What was Ginas total cost before
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
How do I do trebuchet calculations????? Help me please
Ms Graves gave her class 12 minutes to read. Carrie read 5/1/2 pages in that time. At what rate, in the pages per hour, did Carrie read?
This natural landmark was created by the natural forces of erosion. What is its correct name and location?
Which sentence has two antecedents and one pronoun? Laurie likes to bake in her new oven. Cody and Aleena sold their car. My school does not have an October
What statement best describes a republic?
a pine tree measured 40 and 1 over 2 feet tall. Over the next 7 and 1 over 2 years it grew to a height of 57 feet. During the 7 and 1 over 2 years, what was the
Tu as quels cours le jeudi matin?