mrs4hunnid1 mrs4hunnid1
  • 01-06-2017
  • Mathematics
contestada

Find the circumference. Leave your answer in terms of Pi

Find the circumference Leave your answer in terms of Pi class=

Respuesta :

Аноним Аноним
  • 01-06-2017
C = 2 pi r
C = 2 pi (8.4)
C = 16.8 pi cm

answer is C. 16.8 pi cm
Answer Link

Otras preguntas

How has water influenced the development of civilization in Africa
In the years preceding World War I A)world tensions declined. B)military expenditures decreased. C)imperialistic ambitions seemed to decline. D)there was a s
Which word has the long e sound? a. client b. inferior c. beautiful d. poetic
how to i do 7/16÷(31/2÷1/2)
A tabletop in the shape of a trapezoid has an area of 6,550 square centimeters. Its longer base measures 115 centimeters and the shorter base is 85 centimeters.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Tu as quels cours le jeudi matin?
The section of the small intestine between the duodenum and ilium?
Specify, "have" in these proposals is to shock or unstressed? 1) They have not lived here for years. 2) He has a house near the river. 3) Have you finished your
a pine tree measured 40 and 1 over 2 feet tall. Over the next 7 and 1 over 2 years it grew to a height of 57 feet. During the 7 and 1 over 2 years, what was the