charity7
charity7 charity7
  • 01-03-2017
  • Mathematics
contestada

Please help thank you so much

Please help thank you so much class=

Respuesta :

Аноним Аноним
  • 01-03-2017
so meagure the b side than the a side than theres ur answer
Answer Link

Otras preguntas

Really need some helpUse the diagram below. Write AD/AB in simplest form.
With the two endpoints of a diamter how many right triangles can be formed
Question 16 (5 points)   How are the two angles related? Question 16 options: adjacent complementary supplementary vertical
A transit train from Boston to New York and a passenger train from New York to Boston departed at the same time, at 3:00 PM. The distance between New York stati
What is the First Language On world?
how much longer is a 1-inch button than a 3/8-inch button?how much longer is a 1-inch button then a 3/8
Brainliest!!!!!!!! Which person might most rely on implied meanings when they speak or write A) government official writing a report B) judge delivering a
How did the Hellenistic kings spread Greek culture
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Suppose that a particular artillery piece has a range r = 5710 yards . find its range in miles. use the facts that 1mile=5280ft and 3ft=1yard