thadeushastietd9pg4b thadeushastietd9pg4b
  • 01-07-2022
  • History
contestada

What is the moral of the Mid-Autumn festival to eat moon cakes

Respuesta :

kamilatilfordroland kamilatilfordroland
  • 01-07-2022

Answer:

Mooncakes were originally used to offer sacrifices to the Moon God. Later, people began to appreciate and taste the moon cakes as a symbol of family reunion. Gradually, mooncakes became a necessary gift for festivals

Explanation:

Answer Link

Otras preguntas

what are 2 points on the graph for 6x-5y=25
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
as an allied health worker the single most important thing you can do to prevent the spread of disease is A. take antibiotics B. use antibacterial gel C. wash
Compliant is to stubborn as excited is to
An archer’s arrow follows a parabolic path. The height of the arrow f(x) is given by f(x) = -16x^2 + 200x + 4, in feet. Find the maximum height of the arrow.
Failure to incorporate _______ can easily lead to _______. Would the answer be: citations, plagiarism?
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
Please help with math question and please show ALL work. 1....How many solutions does the equation 3x+x+3=2(2x+1)+1 have? 2...How many solutions does the pair
In which sentence does the prepositional phrase act as an adverb? A. Last evening, Anne suffered from a headache. B. The door to the attic was left open. C. Mr
accurate estimation 719-348