arriana1
arriana1 arriana1
  • 02-02-2017
  • English
contestada

What does the body of an informational article usually contain

What does the body of an informational article usually contain class=

Respuesta :

ashlynnmb ashlynnmb
  • 02-02-2017
you are right! Support for the main idea.
Answer Link
joshbarr101
joshbarr101 joshbarr101
  • 01-08-2018

Indeed you are correct it is to support the main idea or theme

Answer Link

Otras preguntas

as an allied health worker the single most important thing you can do to prevent the spread of disease is A. take antibiotics B. use antibacterial gel C. wash
Which of the following was not an accomplishment of the emperor Trajanlegalized Christianity       built bridges, aqueducts and harbors       reduced taxes
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
according to the United States constitution the president has the power to (A) negotiate treaties (B) amend the constitution (C) impeach members of congress
what might be learned from an incorrect hypothesis
Mrs.Henderson had 7/12dozen eggs in her refrigerator.Then she used 1/6 dozen eggs to make a cake.What fraction of a dozen is left?
Which of the following is NOT a form of formal debate? A. an argument B. policy debate C. parliamentary debate D. Lincoln-Douglass debate
what are the 2 major types of cofactors?
the temperature of a sample of matter is a measure of the ?
Specify, "have" in these proposals is to shock or unstressed? 1) They have not lived here for years. 2) He has a house near the river. 3) Have you finished your