nikndawn nikndawn
  • 01-06-2022
  • Mathematics
contestada

Of the equations listed below, which represent functions that are linear?
1.y = 3x
II. y = 3x²
III. y
A. Equations I and III
B. Equation I only
C. Equations II and III
D. Equation II only ​

Of the equations listed below which represent functions that are linear 1y 3x II y 3x III y A Equations I and III B Equation I only C Equations II and III D Eq class=

Respuesta :

joserequejo joserequejo
  • 01-06-2022

Answer:

c i think

Step-by-step explanation:

c because jesus told it was c

Answer Link

Otras preguntas

a summary about concussions
Solve the equation -10 + 3x + 5x = -56 ? ??
How many combinations of 5 students can a teacher choose from 24 students? A. 5,100,480 B. 42,504 C. 7,962,624 D. 120
find the prime factorization 504
amy wants to carpet a room that is 12 feet by 8 feet. how many square yards of carpet will she need to complete the room?
Why did the french revolution happen and who's fault was it
How did i travel irf i went from nyc to tren ton a distance of90 miles at45 miles per hour how long did it take
Which sentence does not contain any errors in comma usage? A. If you ever visit New Haven, Connecticut, be sure to eat at Sally's Pizza. B. The original Londo
Which statement accurately describes the significance of the Magna Carta? A. It gave absolute power to the English king over the church and nobility. B.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5