LegobuilderC LegobuilderC
  • 03-05-2022
  • Advanced Placement (AP)
contestada

Aside from the area in the map, desertification is an issue in other parts of the world EXCEPT Map outlining the African Sahel in a light brown color. the United States China Argentina Mongolia South Korea

Respuesta :

jalend9748 jalend9748
  • 03-05-2022

Answer:

c

Explanation:

Answer Link

Otras preguntas

Compare or Contrast - Jack London's "War" and Ambrose Bierce's "Horseman in the Sky." DUE TODAY!!!
In the united states during world war ii, the property of japanese americans was confiscated, and they were forcibly placed in ______.
Why did the United States go to war with Britain in 1812
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
List and briefly describe each of the five strength training principles. (Site 1)
If 2/3 + 6 = 7/6p, what is the value of p?
If f(x) = x2 – 25 and g(x) = x – 5, what is the domain of mc006-1.jpg?
When did christianity become the official religion of the roman empire?
Will bought a package of 24 juice bottles for $7.44. Which equation relates the cost, c, of a package of juice bottles to the number of bottles, b, in the packa
PLEASE HELP!!!! Only 8 of those will match up