bobbykray17890 bobbykray17890

01-02-2022
Biology

contestada

Animal cells do not have cell walls. true or false

Respuesta :

gabrielherring200 gabrielherring200

01-02-2022

Answer:

True animal cells do not have cell walls. its just the membrane.

Explanation:

Answer Link

Otras preguntas

What was one of the two major goals that the national organization for women work towards when it was first founded?

The federalist papers were published in 1787 and 1788 to help gain support for

What does the word "Islam" mean?

Write a review of your favorite TV programme.Include the name and type of programme, a description of the programme and why you like it.

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Write one or two sentences about the main idea or purpose of the article.

What does the lambic system do? A. registers feelings, such as fear and pleasure B. directs incoming sensory messages C. coordinates involuntary muscle movemen

Suppose the heights of 18-year-old men are approximately normally distributed, with mean 67 inches and standard deviation 5 inches. (a) what is the probability

Joseph and cleoma, who made the first cajun recording, were husband and wife

Molly is buying a house for $202,000. she is financing $185,500 and obtained a 30 year fixed rate mortgage with a 5.125% interest rate. How much are her month