fn286mw fn286mw
  • 01-12-2021
  • English
contestada

Which element of the story is most clearly shown in this passage?

Which element of the story is most clearly shown in this passage class=

Respuesta :

inalysore inalysore
  • 01-12-2021

Answer: Character

Explanation: I was torn between dialogue and character, but decided on character. I believe your chosen answer is correct as the way Mia talks and expresses her opinions is part of her character and who she is. Dialogue was only a second option because it related to the word "talk".

Answer Link
soupyummyboi
soupyummyboi soupyummyboi
  • 01-12-2021
Answer is A i’m pretty sure
Answer Link

Otras preguntas

Solve for x and y: x-3y=-8 3x+2y=31
Throughout most of the war, southern forces suffered from a chronic shortage of food and supplies. a. True b. False
help me asap !!!!!!!!
True or false: martini di arma di taggia invented the martini in 1911 for john d. rockefeller at new york's hotel knickerbocker.
Why is the epa considered to be one of the most powerful bureaucracies?
The federal government's insurance program for the elderly and disabled is called:
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Proof: it is given that angle 1 and angle 2 are supplementary. angle 1 and angle 3 are also supplementary, so angle 2 is equal or equivalent to angle 3. since _
What is the distance between points (-42, 63) and (-39, 67)?
Through what system is glucose delievered to cells for cellular respiration