yocelincelestino101
yocelincelestino101 yocelincelestino101
  • 02-06-2021
  • Mathematics
contestada

Is this right and can someone show me the explanation plz?and how to do the problem I have to show my work

Is this right and can someone show me the explanation plzand how to do the problem I have to show my work class=

Respuesta :

kkozume27
kkozume27 kkozume27
  • 02-06-2021

Answer:

yes it is.

x = 4 and y = -3

Step-by-step explanation:

Solve simultaneously using elimination method:

equation 1 - equation 2

3x + y = 9 equation 1

-2x + y = 5 equation 2

_________

x = 4

plug 4 into any of the 2 equations and solve for y.

3(4) + y = 9

12 + y = 9

12-12 + y = 9-12

y = -3

Answer Link

Otras preguntas

An archer’s arrow follows a parabolic path. The height of the arrow f(x) is given by f(x) = -16x^2 + 200x + 4, in feet. Find the maximum height of the arrow.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
How well did feudalism establish order in the Middle ages?
This natural landmark was created by the natural forces of erosion. What is its correct name and location?
Which of the following is NOT a form of formal debate? A. an argument B. policy debate C. parliamentary debate D. Lincoln-Douglass debate
A shelf at a bookstore displays 27 books. Of these 27 books, 9 of the books are nonfiction books. The store owner adds 6 new fiction books to the shelf and want
5. On average, how many years earlier do smokers die than nonsmokers? (Points : 1) 5 to 6 10 to 11 13 to 14 19 to 20
How did the mountains in Greece contribute to the rise of city-states?
In which sentence does the prepositional phrase act as an adverb? A. Last evening, Anne suffered from a headache. B. The door to the attic was left open. C. Mr
Please answer theses division problems!! 9 divided by 3/7