maria20002 maria20002

03-12-2016
Mathematics

contestada

what expression can be used to find total discount of 30%

Respuesta :

OmarWalid OmarWalid

03-12-2016

If you want to find a price of something after being discounted by 30%
Then
30/100 x The price of the item
Example;):
Price of 20$ after being discounted by 30%
so,
30/100 x 20
= 6
We now know the total which is going to be discounted so
20-6 = 14$

Answer Link

Otras preguntas

A horse weighs 240 kg. If its running at a speed of 18 m/s, what's the linear momentum of the horse

PLS HELP IM TIMED!!!What percent of Québec's residents speak French as their first language?60%70%80%90%

J.T. wants to use a more appropriate transition in sentence 11. Which of the following can best replace Furthermore in this sentence? a. for example b. in conc

Match the appropriate food item with the indicator chemical you would use to detect the principal organic molecule present in that item. Note: some indicator ch

Solve |p+3|= 5. Graph the solution set.

Yo no sé dónde __________________ mi lápiz. ser or estar

A set of object that share a common structure and common behavior in database is called

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

2. The Great Green Wall was a plan to * (5 Points) revitalize the urban areas in African cities slow down the desertification in the Sahel O build more parks al

-2/8, -0.2, -3/7 from least to greatest???