uj7eu2k922 uj7eu2k922

04-05-2021
Mathematics

contestada

4^-3 x 4^0
Evaluate the expression. Explain your work.

PLEASE HELP

43 x 40 Evaluate the expression Explain your work PLEASE HELP class=

Respuesta :

cosmos123stitch cosmos123stitch

04-05-2021

the answer isn't a whole number it is a fraction and the fraction is 1/64 your welcome

Answer Link

Otras preguntas

What kind of feelings do you have when you look at certain colors write you answer in complete paragraph

ANSWER THIS ASAP 20 POINTS Can someone tell me what are the good things and bad things of online school and going to school please? feel free to search some of

Which of the following sentences uses quotation marks correctly? A. “Mother.” said Judy, I love my new sweater. B. Mother, “said Judy,” I love my new sweater. C

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

Are these 5 voice changes correct ?

In an urban area, you can expect ____. A. sparse population and many roads. B. dense population and many roads. C. Sparse population and little development. D.

I NEED HELP PLEASE If given the following Graph; Andre earns $4000 a month at his new job. In order to track his spending and saving, he created a monthly budge

Order the following fractions from least to greatest:1/3 1/4 5/8

which two usda food groups are most likely to supply iron?

What is 32 divided by 55