pariso82 pariso82
  • 03-05-2021
  • Biology
contestada

Template Strand - A-T-G-C-A-T-G-T-C-A-C-C
T-A-C-G-T-C-A-G-T-G-G|
2. You just wrote in the template strand of DNA. Use the template strand to transcribe a strand
of mRNA
mRNA

Respuesta :

clarareina04 clarareina04
  • 03-05-2021

Answer:

UACGUACUGGAUGCAGUCACC

Explanation:

Answer Link

Otras preguntas

Mañana nosotros ________ al museo a las diez de la mañana. A. irás B. iremos C. irán D. iré
1) Emily wants to create snack bags for a trip she is going on. She has 6 granola bars and 10 pieces of dried fruit. If the snack bags should be identical witho
4. What is the value of x in the equation below?14.3 -0.4x = 2.6x + 5.6​
Complete the following sentence. You can use a _____ and a coordinating conjunction to join two independent clauses. semicolon colon comma dash
perform the indicated operation 1 1/3 × 3 3/4​
Which transformation maps trapezoid 2 to trapezoid 6?​
What was Kentuck’s nickname for Tommy Luck?
A pipe has a diameter of 20cm. What is the cross-sectional area of the pipe with units m^2.
These tables represent an exponential function. Find the average rate of change for the interval from x=9 to x=10
At what frequency will a 31.0 mH inductor have a reactance of 637.0 Ω?