jaybro2778 jaybro2778

02-04-2021
Mathematics

contestada

A marble has a volume of 524 cubic feet. What is the approximate diameter of the marble?

Respuesta :

02-04-2021

Cut it in 1/2 to get the answer of 262

Answer Link

sonyyipayop sonyyipayop

02-04-2021

262

Step-by-step explanation:

in half a circle will get the answer

Answer Link

Otras preguntas

If a cell lost the ability to make its own proteins what organelle is likely not working properly? A. Ribosomes b. Cell membrane C. Chloroplast D. Mitochondria

Do u want th then answer this

The table below gives a record of variations of the values of y with the values of x. Draw a scatter plot for the data.

13) * 6 points If a ticket for a single skydiving session is $28.50 and there are 5 people in your group, how much would the total amount for your group's ticke

Civil rights in the United States are meant to make sure that: A. all races are treated equally. B. states can segregate services. C. the courts don't have too

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

what kind of chemical reaction is this?

(06.01 MC) Why were many factories built in New England in the 1800s? (1 point)

timothy euology^^ due tommrow

You purchase 5 pounds of apples and 2 pounds of oranges for $9. Your friends purchases 5 pounds of apples and 6 pounds of oranges for $17. What is the price per