avalosc57 avalosc57

02-02-2021
Mathematics

contestada

Henry, Jaime, and Kayla each had 3 snacks packed in their lunch boxes. They each ate one snack in the morning. How many snacks are left in all?

Respuesta :

jonesqeyarah124 jonesqeyarah124

02-02-2021

Answer:

Step-by-step explanation:

Answer Link

msyalamanchi msyalamanchi

02-02-2021

Answer:

6

Step-by-step explanation:

9 - 3 = 6

Answer Link

Otras preguntas

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

Can you help me plz I think it’s b or c

i need a little help i dont understand this question

What were the 3 causes of the America revolution?

Why might some people think communism is a better way to run an economy

Slepoy Company opened a new flower store and completed the following transactions during September:1. Shareholders invested $80,000 cash in exchange for common

THE OPTIONS ARE THE CAPITAL SENTENCES Select the correct text in the passage. Read this excerpt from a speech that British Prime Minister Winston Churchill made

True or false? A purebred plant has a heterozygous genotype. Please help

I need work shown help

Find the 8th term of the geometric sequence 6, -12, 24, ...