kirichenkon
kirichenkon kirichenkon
  • 01-02-2021
  • Mathematics
contestada

Aaaaa it like a test

Aaaaa it like a test class=

Respuesta :

z0mba
z0mba z0mba
  • 01-02-2021

Answers below.

Decimal: 1.2

Percent: 120%

-zomba

Answer Link
Аноним Аноним
  • 01-02-2021

Answer:

1.20 decimal form 120 as a percent.

Step-by-step explanation:

Answer Link

Otras preguntas

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
A frequenter of a pub had observed that the new barman poured in average 0.47 liters of beer into the glass with a standard deviation equal to 0.09 liters inste
Can somebody help me out with this Spanish work please? If you could that'd be much appreciated! *100 points*
Help meeeeeeeeeeeeeeeeeeeeee
How to identify Double replacement
What is 5x²+7x-9-4x²-x+18?
1-4. Underline the subject pronouns. 1. Maggie tried to put out the fire, but she couldn't. 2. The firefighters were worried, so they kept a careful lookout 3.
Mark all that apply. What purposes does Phi-oo serve in the novel? He translates for Mr. Cavor. He acts as Mr. Cavor’s guide. He is Mr. Cavor’s foe. He protects
Find the quotient. (6x ^2 + 23x + 20) ÷ (5 + 2x) a) 3x - 4 b) 3x + 4 c) 3x +19
A plant produces seed cones and pollen cones . Is it vascular? To what group of plants does it belong