F0R3V3Rmusic F0R3V3Rmusic

03-12-2014
Mathematics

contestada

-3/5x+y=-4

What is the slope-intercept form? I'm in 7th grade.

Respuesta :

Madision Madision

03-12-2014

-3/5x+y=-4
Add 3/5x to both sides.
The slope intercept form is y = 3/5x - 4

Answer Link

AxePikachu AxePikachu

03-12-2014

-3/5x+y=-4
y=3/5x-4
that's the answer

Answer Link

Otras preguntas

Makayla charges 20 cents per square inch for her frame. How much will she charge for a frame that measures 18 inches on each side and has a width of 3 inches ?

1/3d=45 it is a equation math problem

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

What does the letter written by the Chinese emperor Wen tell us about the relationship Between China and the xiongnu

64 1/3 + 243 2/5 Simplify show all work

. What number should be added to 77 to make the sum 0? (5 points) -76 0 77 -77

In OY, shown below, the radius is 34 units, AB = 60 units, and the measure of arc AC is 71 degrees.Find each measure.

The APR of Burt's savings account is 2.5%, but interest is compounded only once a year. What is the APY of Burt's savings account? O A. 2.5% O B. 1% O C. Greate

An aluminum metal rod is heated to 300oC and, upon equilibration at this temperature, it features a diameter of 25 mm. If a tensile force of 1 kN is applied axi

What is the wavelength of a wave that has a speed of 350 meters/second and a frequency of 140 hertzDoes sound travel faster in a warm room or a cold room? Expla