Ka6rahhanscan Ka6rahhanscan

02-10-2016
Mathematics

contestada

find the quotient. 4/20÷1/5

Respuesta :

02-10-2016

4/20 = 1/5
Therefore we can rewrite the problem as:
1/5 divided by 1/5
The answer is therefore 1.

Answer Link

Otras preguntas

If two objects travel through space along two different curves, it's often important to know whether they will collide. (Will a missile hit its moving target? W

what is the complement and supplement of 35 degrees

-5 x 7 + 9 x 5/5 What is the answer

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

The "Three Alls" policy is an example of which of the following: Total War Guerrilla War Civil War Limited War

the line on the graph passes through the points A (0, 6) and B (3, 0)

Help me pls I’ll give brainliest pls dont answer if you don’t know

Solve for X. Please solve all four. First person to do so will get brainliest.

Nosotros ________ los esquís ayer. a. compré b. compraron c. compramos !!!!!!!!!!!!!!!!!!!!!! please help !!!!!!!!!!!!!!!!!!!!! I will give Brainliest for the

What is the average rate of change for f(x) = 2X – 12 over the interval 4sxs8? A) 10 B) 30 60 D 90