prasadanjalie85 prasadanjalie85

03-04-2020
Mathematics

contestada

what is ( 2x+3)(x-4) as a polynomial

Respuesta :

caitlynreilly caitlynreilly

03-04-2020

Answer:

Polynomial: 2x^2-8x+3x-12

Trinomial: 2x^2-5x-12

Step-by-step explanation:

Just distribute the 2x to the x and -4 and then distribute the 3 to x and -4.

Answer Link

Otras preguntas

5. Mrs. Parker is providing lunch at her next staff meeting. She will pay $15.75 for 3 people to eat lunch. At this rate, how much will it cost Mrs. Parker to f

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

Where was wheat first domesticated?

What could the answer be ? And how could it even be answered

A reaction was performed in which 3.4 g of benzoic acid was reacted with excess methanol to make 1.2 g of methyl benzoate. Calculate the theoretical yield and p

Which is the final product of ecological succession? A. climax community B. ecosystem C. secondary succession

If 75 ml of water is added to 125 ml of a 0.45 M NaOH solution. what will be the molarity of the diluted solution be? Vouransion

Which inequality represents the graph below

The effectiveness of DNA evidence in court depends on the ability of the witness to explain the probability that no other person, except an identical twin has t

What is the area of this figure