plivianah plivianah
  • 03-12-2019
  • Mathematics
contestada

2 and 3. Please help?!?!?!?!?!!!!????!

2 and 3 Please help class=

Respuesta :

dayanara4750 dayanara4750
  • 03-12-2019

Answer:

#2; =572

#3;= no i do not agree

Step-by-step explanation:

#2= 7436/13=572

#3=3084/250=12.336 its a decimal not a whole number

Answer Link

Otras preguntas

what are the zeros of the function? f(x)=+-6x
Which of the following statements is true regarding the Central Limit Theorem? The samples are dependent. The sample size is small. The sample mean is not no
The term used when an organism is studied in its natural environment is
Two sides of a triangle have the following measure of 7,8.what is the range of possiable values for the 3rd side?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Please help with geometry!!!
What is the lowest level of measurement that a median can be computed?
Find the number. Six times a number is 9 more than three times the number. The number is |___| What I’m thinking right now “6x=27”
from what you have heard about modern war
NEED HELP ASAPPPPPPP