jaidenrbrown jaidenrbrown

02-05-2019
Mathematics

contestada

What is the best estimated of the total number of students that attended clubs on Friday

What is the best estimated of the total number of students that attended clubs on Friday class=

Respuesta :

mrscriptixx mrscriptixx

02-05-2019

All you would have to do is round to the nearest 10th number (ex. From 26 to 30) for all the clubs including both boys and girls. Then you add them all together. Rounding makes estimating easier.

Answer Link

Otras preguntas

an explanation describe if an orange pet mates with another orange pet, can they have any green offspring.

A youth ice hockey game has 3 periods that are each 20 minutes long. Colin plays 12 minutes each period. Which ratio shows Colin's playing time compared to the

one-third of the fish in Liam's fish tank were added today. Half of the other fish were a gift to Liam last week. the other 9 came from Liam's old fish tank.

The sum of three numbers is 84 the second number is 2 times the third the first number is 8 more than the third what are the numbers

The area of the base of a prism is 50 mm2. The perimeter of the base is 30 mm. The height of the prism is 7 mm. What is the surface area of the prism?

Help PleaSE:) ->Grammar Which sentence has a pronoun with an unclear, missing, or confusing antecedent? A. The lifeguards sat in tall chairs; they could

why is the square root of a perfect square always rational

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5

accurate estimation 719-348

A standard coffee mug has a capacity of 16 fluid ounces. If Annie needs to fill 26 mugs with coffee, how many total quarts of coffee does she need?