skylarrrrr51511 skylarrrrr51511

03-10-2018
Mathematics

contestada

A store clerk has 45 shirts to pack in boxes. Esch box hold 6 shirts what is the fewest boxes the clerk will need to pack akk the shirts

Respuesta :

carterboo3366 carterboo3366

03-10-2018

the fewest boxes is 8 because if you do 7 you are below but if you do 7.5 you can't because you can't use half a box but 8 is a whole box which will fit everything

Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5

Can someone explain the equation Q = M C delta T or Q = MCΔT Thanks!

Who was the Queen of England when Shakespeare first became known as a great playwright? A. Elizabeth I B. Mary Tudor C. Victoria D. Anne Boleyn

What was George Washington's nickname?

A standard coffee mug has a capacity of 16 fluid ounces. If Annie needs to fill 26 mugs with coffee, how many total quarts of coffee does she need?

An archer’s arrow follows a parabolic path. The height of the arrow f(x) is given by f(x) = -16x^2 + 200x + 4, in feet. Find the maximum height of the arrow.

The sum of three numbers is 84 the second number is 2 times the third the first number is 8 more than the third what are the numbers

Which is the best description of civil liberties? A. natural rights B. privileges C. rights guaranteed by law D. democratic goals E. trial procedures

who fought against each other in the crusades?

Solve 2x2 - 8x = -7 Which of the following is a solution of x2 + 5x = -2?